Comments on: Influenza PB1-F2 protein and viral fitness

By: gsgs

gsgs — Thu, 15 Apr 2010 18:03:25 +0000

OK, so this is the same as PB1 with the first 117 nucleotides=39 amino-acids
of the coding region missing.
(I meant A/CA/07/2009(H1N1), but it doesn't matter)

Some of the 30-60 PB1-proteins in the virus are of this truncated form ?
While the genomic RNA inside the one PB1-ribonucleoprotein complex
is always full length.

By: Ying-Chen,Wang

Ying-Chen,Wang — Thu, 15 Apr 2010 15:10:21 +0000

Here is the coding sequence for N40. Extracted from influenza strain A/California/UR06-0347/2007(H3N2). Since the N40 is a newly discovered protein. It has not been annonated in GenBank. When compared with full length PB1, N40 lacks 40 amino acid residues in its N-terminal.

ATGGACACAGTCAACAGAACACACCAATATTCAGAGAAGGGGAAGTGGACGACAAATACAGAAACTGGGGCACCCCAACTCAACCCAATTGATGGACCACTACCTGAGGATAATGAACCAAGTGGATATGCACAAACAGACTGTGTCCTGGAGGCTATGGCCTTCCTTGAAGAATCCCACCCAGGTATCTTTGAGAACTCATGCCTTGAAACAATGGAAGCCGTTCAACAAACAAGGGTGGACAAACTAACCCAAGGTCGCCAGACTTATGATTGGACATTAAACAGAAATCAACCGGCAGCAACTGCATTAGCCAACACCATAGAAGTTTTTAGATCGAACGGATTAACAGCTAATGAATCAGGAAGGCTAATAGATTTCCTCAAGGATGTGATGGAATCAATGGATAAAGAGGAAATGGAGATAACAACACACTTTCAAAGAAAAAGGAGAGTAAGGGACAACATGACCAAGAAAATGGTCACACAAAGAACAATAGGGAAGAAAAAACAAAGAGTGAATAAGAGAGGCTACTTAATAAGAGCTTTGACATTGAACACGATGACCAAAGATGCAGAGAGAGGCAAATTAAAAAGAAGGGCTATTGCAACACCCGGGATGCAAATTAGAGGGTTCGTGTACTTCGTTGAAACTTTAGCTAGAAGCATTTGCGAAAAGCTTGAACAGTCTGGACTTCCGGTTGGGGGTAATGAAAAGAAGGCCAAACTGGCAAATGTTGTGAGAAAAATGATGACTAATTCACAAGACACAGAGCTTTCTTTCACAATCACTGGGGACAACACTAAGTGGAATGAAAATCAAAACCCTCGAATGTTTTTGGCGATGATTACATACATCACAAAAAATCAACCTGAGTGGTTCAGAAACATCCTGAGCATCGCACCAATAATGTTCTCAAACAAAATGGCAAGACTGGGAAAAGGATACATGTTCGAGAGTAAGAGAATGAAGCTCCGGACACAAATACCTGCAGAAATGCTAGCAAGCATTGACCTGAAGTATTTCAATGAATCAACAAGGAAGAAAATTGAGAAAATAAGGCCTCTTCTAATAGATGGCACAGCATCATTGAGCCCTGGAATGATGATGGGCATGTTCAACATGCTAAGTACGGTTTTAGGAGTCTCGATACTGAATCTTGGACAAAAGAAATACACCAAGACAACATACTGGTGGGATGGGCTCCAATCCTCCGACGATTTTGCCCTCATAGTGAATGCACCAAATCATGAGGGAATACAAGCAGGAGTGGATAGATTCTACAGGACCTGCAAGTTAGTGGGAATCAACATGAGCAAAAAGAAGTCCTATATAAATAAAACAGGGACATTTGAATTCACTAGCTTTTTTTATCGATATGGATTTGTGGCTAATTTTAGCATGGAGCTGCCCAGTTTTGGAGTGTCTGGAATAAACGAGTCAGCTGATATGAGCATTGGAGTAACAGTGATAAAGAACAACATGATAAACAATGACCTTGGACCAGCAACAGCCCAAATGGCTCTCCAATTGTTCATCAAAGATTACAGATACACATATAGGTGCCATAGAGGAGACACACAAATCCAGACGAGAAGATCATTCGAGCTAAAGAAGCTGTGGGATCAAACCCAATCAAGGGCAGGACTATTGGTATCAGATGGGGGACCAAACTTATACAATATCCGGAATCTTCACATCCCTGAAGTCTGCTTAAAGTGGGAGCTGATGGATGAGAATTATCGGGGAAGACTTTGTAATCCCCTGAATCCCTTTGTCAGCCATAAAGAAATTGAGTCTGTAAACAATGCTGTAGTAATGCCAGCCCATGGTCCGGCCAAAAGTATGGAATATGATGCCGTTGCAACTACACACTCCTGGATTCCCAAGAGGAACCGCTCTATTCTAAACACAAGCCAAAGGGGAATTCTTGAGGATGAACAGATGTACCAGAAGTGCTGCAACTTGTTCGAGAAATTTTTCCCTAGTAGTTCATATAGGAGACCGATTGGAATTTCTAGCATGGTGGAGGCCATGGTGTCTAGGGCCCGGATTGATGCCAGAATTGACTTCGAGTCTGGAAGGATTAAGAAGGAAGAGTTCTCTGAGATCATGAAGATCTGTTCCACCATTGAAGAACTCAGACGGCAAAAATAA

By: gsgs

gsgs — Thu, 15 Apr 2010 14:52:37 +0000

thanks. What means: “n-term trancated varirant” ?
Could you post the nucleotide-sequence that encodes an N40 protein
from one public virus, e.g. vaccine strain A/CA/07 ?

By: Ying-Chen,Wang

Ying-Chen,Wang — Thu, 15 Apr 2010 14:35:47 +0000

N40 is just an n-term trancated varirant of polymerase base 1. Pandemic influenza H1N1 2009 has it, but has no functional PB1-F2. According to the study you cited here, it is rational to predict that the expression of N40 should be up regulated in pandemic influenza H1N1 2009. There was also a report from Rong Hai (2010) on jvi that introducing full length PB1-F2 into pandemic influenza H1N1 2009 strains did not alter its virulence on BALB/c mice or ferret. The relationship between PB1, PB1-F2 and N40 should be investigated thoroughly.

By: gsgs

gsgs — Thu, 15 Apr 2010 11:03:25 +0000

By: wjak

wjak — Thu, 15 Apr 2010 08:10:21 +0000

By: gsgs

gsgs — Thu, 15 Apr 2010 07:52:37 +0000

thanks. What means: “n-term trancated varirant” ?
Could you post the nucleotide-sequence that encodes an N40 protein
from one public virus, e.g. vaccine strain A/CA/07 ?

By: wjak

wjak — Thu, 15 Apr 2010 07:35:47 +0000

By: uberVU - social comments

uberVU - social comments — Sun, 08 Nov 2009 17:31:13 +0000

Social comments and analytics for this post…

This post was mentioned on Twitter by ResearchBlogs: Influenza PB1-F2 protein and viral fitness http://bit.ly/4Eww2Q...

By: max191

max191 — Wed, 07 Oct 2009 13:06:53 +0000

Your blog is very interesting. I would like to tell that I have been looking for such information and finally got it. Thanks a lot.
regards
charcoal grill

By: gsgs

gsgs — Sat, 12 Sep 2009 09:13:20 +0000

PB1-F2 is mainly truncated in humans,swine,poultry while most wild birds
have a full PB1-F2. After some time of evolution outside wild birds
it may become reduced in length or get disfunctional.
http://www.setbb.com/fluwiki2/viewtopic.php?p=1901
So apparantly it is important in wild birds but not in mammals, poultry.
Where are poultry different from wild birds ? Anatomy is the same, so
presumably it's the way of living, the spread of the virus.
For wild birds fecal-oral is important while for mammals,poultry it's
repiratory ? For wild birds it spreads by flying. Someone please test
why a truncated PB1-F2 is bad for wild birds …

Now, the idea is to help the virus a bit, truncate PB1-F2 in humans so it
spreads better and outcompetes old H3N2 (if mexflu should fail to do this…)
but at the same time also becomes less virulent.
Hey, the idea is to create a flu as mild as a cold but also as frequent
Flu alone is not so much interested to do this, if we don't help it,
it's just interested in wild birds, where it reassorts like crazy.

By: Fitness Blogger » Blog Archive » Influenza PB1-F2 protein and viral fitness

Sun, 30 Aug 2009 12:53:19 +0000

[...] Vincent Racaniello wrote an interesting post today onInfluenza PB1-F2 protein and viral fitnessHere’s a quick excerpt [...]

By: cupton

cupton — Sun, 30 Aug 2009 02:02:12 +0000

Evolutionary selection surely only selects for fitness. If some trait that increases fitness also increases what we characterize as virulence, then it's selected for. Otherwise, yes, very high virulence probably limits “fitness” (eg myxoma in Aussie rabbits). Both the current H1N1 and 1918 flu seemed to spread pretty well (equally well?). Probably due to little immunity in the population. Are the differences in virulence related to this fitness?

By: h1n1_watcher

h1n1_watcher — Sat, 29 Aug 2009 12:22:40 +0000

I still think that fitness and pathogenicity are not independent properties.
Increased pathogenicity will, all other things being equal (!), eventually reduce fitness.

Think about the current flu pandemic: The reaction of the world would have been different if the virus would have been more virulent: strict quarantaine, economical shutdown, social distancing, shool closing, even more accelerated vaccine development: all those "defense mechanisms of the host population" would have happened in increased intensity with increased virus pathogenicity thus certainly succesfull in at least slowing its spread, i.e. reducing its fitness.

The most successful virus of the world (in terms of prevalence, i.e. fitness) is at the same time the least virulent: the ordinary rhino virus, responsible for the "common cold".

By: gsgs

gsgs — Sat, 29 Aug 2009 04:15:02 +0000

can you say something about N40
http://jvi.asm.org/cgi/content/abstract/83/16/8021

By: cupton

cupton — Fri, 28 Aug 2009 19:44:11 +0000

Good article!!
Shows fitness and virulence can be very different beasts.