Influenza PB1-F2 protein and viral fitness

28 August 2009

influenza-rna-2The second RNA segment of the influenza virus genome encodes the PB1 protein – part of the viral RNA polymerase – and, in some strains, a second protein called PB1-F2. The latter protein is believed to be an important determinant of influenza virus virulence. The absence of a full-length PB1-F2 protein has been suggested as one possible determinant for the low pathogenicity of the 2009 influenza H1N1 pandemic strain. Analysis of the evolutionary history of PB1-F2 suggests that it does not contribute significantly to viral fitness – the ability of the virus to replicate.

PB1-F2 binds to mitochondria, leading to a release of cytochrome c and induction of apoptosis in CD8 T-cells and alveolar macrophages. The protein increases the severity of primary viral and secondary bacterial infections in mice, and is associated with the high pathogenicity of avian H5N1 and the 1918 H1N1 pandemic virus.

The PB1-F2 protein is not produced in cells infected with the 2009 H1N1 strain because there are three stop codons at nucleotide positions 12, 58, and 88.  The PB1 segment of the 2009 H1N1 strain is related to PB1 of H1N2 and H3N2 swine viruses from 1998 and human H3N2 viruses. Curiously, all the relatives of the 2009 H1N1 strain in swine and in humans encode a complete PB1-F2 protein. A truncated PB1-F2 is encoded by the genome of classical swine H1N1 viruses and human H1N1 viruses since 1947. But 96% of the avian influenza virus sequences deposited in NCBI as of 2007 encode the full length version of the protein.

Because the full-length PB1-F2 protein is not encoded in the genome of many influenza viruses, its evolutionary role and contribution to the fitness of the virus is unclear. To answer these questions, the evolution of PB1-F2 was compared with PB1 and two other open reading frames of similar size within the same RNA segment that are not translated into protein.

PB1-F2 is complete in all H1N1 human isolates before 1947, when a stop codon appeared which leads to production of a shorter version of the protein – 57 amino acids. If the complete protein conferred a functional advantage to the virus, a change in the evolutionary rates of the human H1N1 PB1-F2 proteins should have occurred in 1947. No such change is observed.

Results of sequence analysis reveal that the PB1-F2 open reading frame is as conserved, and maintained as a full-length protein, as other non-coding regions of the same RNA segment and of a randomly generated PB1 segment. These observations, and the fact that PB1-F2 is truncated in many virus isolates, suggest that the evolutionary role of PB1-F2 in animal hosts is minimal. Why the full length protein is produced by some viruses – and unfortunately leads to higher virulence – remains a puzzle.

Trifonov, V., Racaniello, V., & Rabadan, R. (2009). The Contribution of the PB1-F2 Protein to the Fitness of Influenza A Viruses and its Recent Evolution in the 2009 Influenza A (H1N1) Pandemic Virus PLoS Currents: Influenza

Share this post:
  • TwitThis
  • Digg
  • del.icio.us
  • Facebook
  • Google Bookmarks
  • StumbleUpon
  • gsgs
    OK, so this is the same as PB1 with the first 117 nucleotides=39 amino-acids
    of the coding region missing.
    (I meant A/CA/07/2009(H1N1), but it doesn't matter)

    Some of the 30-60 PB1-proteins in the virus are of this truncated form ?
    While the genomic RNA inside the one PB1-ribonucleoprotein complex
    is always full length.
  • gsgs
    PB1-F2 is mainly truncated in humans,swine,poultry while most wild birds
    have a full PB1-F2. After some time of evolution outside wild birds
    it may become reduced in length or get disfunctional.
    http://www.setbb.com/fluwiki2/viewtopic.php?p=1901
    So apparantly it is important in wild birds but not in mammals, poultry.
    Where are poultry different from wild birds ? Anatomy is the same, so
    presumably it's the way of living, the spread of the virus.
    For wild birds fecal-oral is important while for mammals,poultry it's
    repiratory ? For wild birds it spreads by flying. Someone please test
    why a truncated PB1-F2 is bad for wild birds ...

    Now, the idea is to help the virus a bit, truncate PB1-F2 in humans so it
    spreads better and outcompetes old H3N2 (if mexflu should fail to do this...)
    but at the same time also becomes less virulent.
    Hey, the idea is to create a flu as mild as a cold :-) but also as frequent :-(
    Flu alone is not so much interested to do this, if we don't help it,
    it's just interested in wild birds, where it reassorts like crazy.
  • gsgs
  • Ying-Chen,Wang
    N40 is just an n-term trancated varirant of polymerase base 1. Pandemic influenza H1N1 2009 has it, but has no functional PB1-F2. According to the study you cited here, it is rational to predict that the expression of N40 should be up regulated in pandemic influenza H1N1 2009. There was also a report from Rong Hai (2010) on jvi that introducing full length PB1-F2 into pandemic influenza H1N1 2009 strains did not alter its virulence on BALB/c mice or ferret. The relationship between PB1, PB1-F2 and N40 should be investigated thoroughly.
  • gsgs
    thanks. What means: "n-term trancated varirant" ?
    Could you post the nucleotide-sequence that encodes an N40 protein
    from one public virus, e.g. vaccine strain A/CA/07 ?
  • Ying-Chen,Wang
    Here is the coding sequence for N40. Extracted from influenza strain A/California/UR06-0347/2007(H3N2). Since the N40 is a newly discovered protein. It has not been annonated in GenBank. When compared with full length PB1, N40 lacks 40 amino acid residues in its N-terminal.

    ATGGACACAGTCAACAGAACACACCAATATTCAGAGAAGGGGAAGTGGACGACAAATACAGAAACTGGGGCACCCCAACTCAACCCAATTGATGGACCACTACCTGAGGATAATGAACCAAGTGGATATGCACAAACAGACTGTGTCCTGGAGGCTATGGCCTTCCTTGAAGAATCCCACCCAGGTATCTTTGAGAACTCATGCCTTGAAACAATGGAAGCCGTTCAACAAACAAGGGTGGACAAACTAACCCAAGGTCGCCAGACTTATGATTGGACATTAAACAGAAATCAACCGGCAGCAACTGCATTAGCCAACACCATAGAAGTTTTTAGATCGAACGGATTAACAGCTAATGAATCAGGAAGGCTAATAGATTTCCTCAAGGATGTGATGGAATCAATGGATAAAGAGGAAATGGAGATAACAACACACTTTCAAAGAAAAAGGAGAGTAAGGGACAACATGACCAAGAAAATGGTCACACAAAGAACAATAGGGAAGAAAAAACAAAGAGTGAATAAGAGAGGCTACTTAATAAGAGCTTTGACATTGAACACGATGACCAAAGATGCAGAGAGAGGCAAATTAAAAAGAAGGGCTATTGCAACACCCGGGATGCAAATTAGAGGGTTCGTGTACTTCGTTGAAACTTTAGCTAGAAGCATTTGCGAAAAGCTTGAACAGTCTGGACTTCCGGTTGGGGGTAATGAAAAGAAGGCCAAACTGGCAAATGTTGTGAGAAAAATGATGACTAATTCACAAGACACAGAGCTTTCTTTCACAATCACTGGGGACAACACTAAGTGGAATGAAAATCAAAACCCTCGAATGTTTTTGGCGATGATTACATACATCACAAAAAATCAACCTGAGTGGTTCAGAAACATCCTGAGCATCGCACCAATAATGTTCTCAAACAAAATGGCAAGACTGGGAAAAGGATACATGTTCGAGAGTAAGAGAATGAAGCTCCGGACACAAATACCTGCAGAAATGCTAGCAAGCATTGACCTGAAGTATTTCAATGAATCAACAAGGAAGAAAATTGAGAAAATAAGGCCTCTTCTAATAGATGGCACAGCATCATTGAGCCCTGGAATGATGATGGGCATGTTCAACATGCTAAGTACGGTTTTAGGAGTCTCGATACTGAATCTTGGACAAAAGAAATACACCAAGACAACATACTGGTGGGATGGGCTCCAATCCTCCGACGATTTTGCCCTCATAGTGAATGCACCAAATCATGAGGGAATACAAGCAGGAGTGGATAGATTCTACAGGACCTGCAAGTTAGTGGGAATCAACATGAGCAAAAAGAAGTCCTATATAAATAAAACAGGGACATTTGAATTCACTAGCTTTTTTTATCGATATGGATTTGTGGCTAATTTTAGCATGGAGCTGCCCAGTTTTGGAGTGTCTGGAATAAACGAGTCAGCTGATATGAGCATTGGAGTAACAGTGATAAAGAACAACATGATAAACAATGACCTTGGACCAGCAACAGCCCAAATGGCTCTCCAATTGTTCATCAAAGATTACAGATACACATATAGGTGCCATAGAGGAGACACACAAATCCAGACGAGAAGATCATTCGAGCTAAAGAAGCTGTGGGATCAAACCCAATCAAGGGCAGGACTATTGGTATCAGATGGGGGACCAAACTTATACAATATCCGGAATCTTCACATCCCTGAAGTCTGCTTAAAGTGGGAGCTGATGGATGAGAATTATCGGGGAAGACTTTGTAATCCCCTGAATCCCTTTGTCAGCCATAAAGAAATTGAGTCTGTAAACAATGCTGTAGTAATGCCAGCCCATGGTCCGGCCAAAAGTATGGAATATGATGCCGTTGCAACTACACACTCCTGGATTCCCAAGAGGAACCGCTCTATTCTAAACACAAGCCAAAGGGGAATTCTTGAGGATGAACAGATGTACCAGAAGTGCTGCAACTTGTTCGAGAAATTTTTCCCTAGTAGTTCATATAGGAGACCGATTGGAATTTCTAGCATGGTGGAGGCCATGGTGTCTAGGGCCCGGATTGATGCCAGAATTGACTTCGAGTCTGGAAGGATTAAGAAGGAAGAGTTCTCTGAGATCATGAAGATCTGTTCCACCATTGAAGAACTCAGACGGCAAAAATAA
  • Good article!!
    Shows fitness and virulence can be very different beasts.
  • h1n1_watcher
    I still think that fitness and pathogenicity are not independent properties.
    Increased pathogenicity will, all other things being equal (!), eventually reduce fitness.

    Think about the current flu pandemic: The reaction of the world would have been different if the virus would have been more virulent: strict quarantaine, economical shutdown, social distancing, shool closing, even more accelerated vaccine development: all those "defense mechanisms of the host population" would have happened in increased intensity with increased virus pathogenicity thus certainly succesfull in at least slowing its spread, i.e. reducing its fitness.

    The most successful virus of the world (in terms of prevalence, i.e. fitness) is at the same time the least virulent: the ordinary rhino virus, responsible for the "common cold".

  • Evolutionary selection surely only selects for fitness. If some trait that increases fitness also increases what we characterize as virulence, then it's selected for. Otherwise, yes, very high virulence probably limits "fitness" (eg myxoma in Aussie rabbits). Both the current H1N1 and 1918 flu seemed to spread pretty well (equally well?). Probably due to little immunity in the population. Are the differences in virulence related to this fitness?
blog comments powered by Disqus